Turn off MathJax
Article Contents

Citation:

Shen Qi Wan attenuates renal interstitial fibrosis via upregulating AQP1

  • Author Bio: Yiyou Lin:linyiyou@163.com;Jiale Wei:963622534@qq.com;Yehui Zhang:367339637@qq.com;Junhao Huang:651997242@qq.com;Sichen Wang:1736472769@qq.com;Qihan Luo:461289566@qq.com;Hongxia Yu:ytgx163@163.com;Liting Ji:jltzcmu@sina.com;Xiaojie Zhou:18768155681@163.com;Changyu Li:lcyzcmu@sina.com.
  • Corresponding author: Liting Ji, College of Pharmacy, Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China E-mail address: jltzcmu@sina.com; Xiaojie Zhou, Academy of Chinese Medical Sciences, Zhejiang Chinese Medical University, Hangzhou 310053, China E-mail address: 18768155681@163.com; Changyu Li, College of Pharmacy, Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China E-mail address: lcyzcmu@sina.com
  • Additional file 1:Determination of constituents in Shen Qi Wan by UPLC-Q/TOF-MS
  • SQW, Shen Qi Wan; AQP1, Aquaporin 1; CKD, Chronic kidney disease; RIF, renal interstitial fibrosis; EMT, epithelial-to-mesenchymal transition; RT-PCR, reverse transcription-quantitative PCR; TGF-β1, transforming growth factor-β1; α-SMA, α-smooth muscle actin; CK-18, Cytokeratin 18; E-cadherin, Epithelial cadherin; ECM, Extracellular Matrix; FBS, Fetal Bovine Serum; HK-2, Human kidney proximal tubular cell-2; ILK, Integrin-linked kinase; NRS, Normal rat serum; PBS, Phosphate buffered sodium; RNAi, RNA interference.
  • Available Date: 19-Nov.-2022
  • Shen Qi Wan (SQW), a famous traditional Chinese formula, has great effect on chronic kidney diseases (CKD). Renal interstitial fibrosis (RIF) is the crucial pathway in CKD leading to the end-stage renal failure. However, the underlying mechanism of SQW treat on RIF is unclear and needs further verification. To investigate the effect of SQW on RIF and explore the underlying mechanism of SQW on tubular epithelial-to-mesenchymal transition (EMT) through regulating of Aquaporin 1 (AQP1) expression level. An RIF mouse model was established by administration of adenine, and subsequently treated with SQW (3 or 6 g/kg/d, respectively) for 50 days. Following the treatment period, the levels of kidney functional parameters in serum were detected. The pathological renal changes and degree of fibrosis in the kidneys were analyzed by histological assessment. The expression of EMT-related markers and AQP1 gene expression in kidney tissues were measured using Real-time quantitative PCR (RT-qPCR) and Western blotting. In addition, EMT in HK-2 cells was induced using transforming growth factor-beta1 (TGF-β1), and this was followed by treatment with a serum containing SQW. Subsequently, the molecular mechanism of SQW on EMT was explored in HK-2 cells of AQP1 knockdown. SQW alleviated kidney injury and renal collagen deposition in the kidneys of mice induced by adenine, increased E-cadherin and AQP1 expression at the protein level, and decreased the expression of Vimentin and α-smooth muscle actin (α-SMA). Similarly, treatment with the serum containing SQW upregulated the expression of E-cadherin and Cytokeratin-18 (CK-18), and downregulated the expression of Vimentin and α-SMA significantly in TGF-β1 stimulated HK-2 cells. The expression levels of Snail and Slug were significantly upregulated in HK-2 cells following knockdown of AQP1. AQP1 knockdown increased the mRNA expression levels of Vimentin and α-SMA, while decreasing the expression levels of E-cadherin. The protein expression levels of Vimentin were increased, whereas E-cadherin and CK-18 expression levels were significantly decreased following AQP1 knockdown in the HK-2 cells. These results revealed that AQP1 knockdown promoted EMT. Furthermore, AQP1 knockdown abolished the protective effects of treatment with serum containing SQW on EMT in HK-2 cells. SQW halts EMT process in RIF via upregulation of the expression of AQP1 in kidneys.
  • 加载中
  • [1]

    Mantovani A and Zusi C. PNPLA3 gene and kidney disease [J]. Explor Med, 2020.https://doi.org/10.37349/emed.2020.00004.
    [2]

    Humphreys BD. Mechanisms of Renal Fibrosis [J]. Annu Rev Physiol, 2018, 80: 309-326. doi: 10.1146/annurev-physiol-022516-034227
    [3]

    Rashid I, Katravath P, Tiwari P, et al. Hyperuricemia—a serious complication among patients with chronic kidney disease: a systematic review and meta-analysis [J]. Explor Med, 2022, 3(3): 249-259. doi: 10.37349/emed.2022.00089
    [4]

    Li L, Zhou G, Fu R, et al. Polysaccharides extracted from balanophora polyandra Griff (BPP) ameliorate renal Fibrosis and EMT via inhibiting the Hedgehog pathway [J]. J Cell Mol Med, 2021, 25(6): 2828-2840. doi: 10.1111/jcmm.16313
    [5]

    Roediger B, Lee Q, Tikoo S, et al. An Atypical Parvovirus Drives Chronic Tubulointerstitial Nephropathy and Kidney Fibrosis [J]. Cell, 2018, 175(2): 530-543.e524. doi: 10.1016/j.cell.2018.08.013
    [6]

    Tian J, Xiao Z, Wei J, et al. NCTD Prevents Renal Interstitial Fibrosis via Targeting Sp1/lncRNA Gm26669 Axis [J]. Int J Biol Sci, 2021, 17(12): 3118-3132. doi: 10.7150/ijbs.59195
    [7]

    Liu Y. Cellular and molecular mechanisms of renal fibrosis [J]. Nat Rev Nephrol, 2011, 7(12): 684-696. doi: 10.1038/nrneph.2011.149
    [8]

    Tampe D, Schridde L, Korsten P, et al. Different Patterns of Kidney Fibrosis Are Indicative of Injury to Distinct Renal Compartments [J]. Cells, 2021, 10(8): 2014. doi: 10.3390/cells10082014
    [9]

    Li X, Pan J, Li H, et al. DsbA-L mediated renal tubulointerstitial fibrosis in UUO mice [J]. Nat Commun, 2020, 11(1): 4467. doi: 10.1038/s41467-020-18304-z
    [10]

    Lovisa S, LeBleu VS, Tampe B, et al. Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis [J]. Nat Med, 2015, 21(9): 998-1009. doi: 10.1038/nm.3902
    [11]

    Cao G, Li S, Shi H, et al. Schisandrin B attenuates renal fibrosis via miR-30e-mediated inhibition of EMT [J]. Toxicol Appl Pharmacol, 2019, 385: 114769. doi: 10.1016/j.taap.2019.114769
    [12]

    Zhou T, Luo M, Cai W, et al. Runt-Related Transcription Factor 1 (RUNX1) Promotes TGF-β-Induced Renal Tubular Epithelial-to-Mesenchymal Transition (EMT) and Renal Fibrosis through the PI3K Subunit p110δ [J]. EBioMedicine, 2018, 31: 217-225. doi: 10.1016/j.ebiom.2018.04.023
    [13]

    Liu WR, Lu HT, Zhao TT, et al. Fu-Fang-Jin-Qian-Cao herbal granules protect against the calcium oxalate-induced renal EMT by inhibiting the TGF-β/smad pathway [J]. Pharm Biol, 2020, 58(1): 1115-1122. doi: 10.1080/13880209.2020.1844241
    [14]

    Carew RM, Wang B and Kantharidis P. The role of EMT in renal fibrosis [J]. Cell Tissue Res, 2012, 347(1): 103-116. doi: 10.1007/s00441-011-1227-1
    [15]

    Allison SJ. Fibrosis: Targeting EMT to reverse renal fibrosis [J]. Nat Rev Nephrol, 2015, 11(10): 565. doi: 10.1038/nrneph.2015.133
    [16]

    Grams ME, Chow EK, Segev DL, et al. Lifetime incidence of CKD stages 3-5 in the United States [J]. Am J Kidney Dis, 2013, 62(2): 245-252. doi: 10.1053/j.ajkd.2013.03.009
    [17]

    Zhang JY, Hong CL, Chen HS, et al. Target Identification of Active Constituents of Shen Qi Wan to Treat Kidney Yang Deficiency Using Computational Target Fishing and Network Pharmacology [J]. Front Pharmacol, 2019, 10: 650. doi: 10.3389/fphar.2019.00650
    [18]

    Xiong X, Wang P, Li X, et al. Shenqi pill, a traditional Chinese herbal formula, for the treatment of hypertension: A systematic review [J]. Complement Ther Med, 2015, 23(3): 484-493. doi: 10.1016/j.ctim.2015.04.008
    [19]

    Chen H, Xu Y, Yang Y, et al. Shenqiwan Ameliorates Renal Fibrosis in Rats by Inhibiting TGF-β1/Smads Signaling Pathway [J]. Evid Based Complement Alternat Med, 2017, 2017: 7187038. doi: 10.1155/2017/7187038
    [20]

    Lin Y, Zhang J, Fu Y, et al. The Protective Effect of Shen Qi Wan on Adenine-Induced Podocyte Injury [J]. Evid Based Complement Alternat Med, 2020, 2020: 5803192. doi: 10.1155/2020/5803192
    [21]

    Zhou XH, Zhang AH, Wang L, et al. Novel chinmedomics strategy for discovering effective constituents from ShenQiWan acting on ShenYangXu syndrome [J]. Chin J Nat Med, 2016, 14(8): 561-581. doi: 10.1016/S1875-5364(16)30067-X
    [22]

    Wang X, Zhang A, Zhou X, et al. An integrated chinmedomics strategy for discovery of effective constituents from traditional herbal medicine [J]. Sci Rep, 2016, 6: 18997. doi: 10.1038/srep18997
    [23]

    Huo Z, Lomora M, Kym U, et al. AQP1 Is Up-Regulated by Hypoxia and Leads to Increased Cell Water Permeability, Motility, and Migration in Neuroblastoma [J]. Front Cell Dev Biol, 2021, 9: 605272-605272. doi: 10.3389/fcell.2021.605272
    [24]

    Liu Q, Kong Y, Guo X, et al. GSK-3β inhibitor TDZD-8 prevents reduction of aquaporin-1 expression via activating autophagy under renal ischemia reperfusion injury [J]. FASEB J, 2021, 35(8): e21809. doi: 10.1096/fj.202100549R
    [25]

    Wang F, Wu H, Fan M, et al. Sodium butyrate inhibits migration and induces AMPK-mTOR pathway-dependent autophagy and ROS-mediated apoptosis via the miR-139-5p/Bmi-1 axis in human bladder cancer cells [J]. FASEB J, 2020, 34(3): 4266-4282. doi: 10.1096/fj.201902626R
    [26]

    Day RE, Kitchen P, Owen DS, et al. Human aquaporins: regulators of transcellular water flow [J]. Biochim Biophys Acta, 2014, 1840(5): 1492-1506. doi: 10.1016/j.bbagen.2013.09.033
    [27]

    Li J, Zhang M, Mao Y, et al. The potential role of aquaporin 1 on aristolochic acid I induced epithelial mesenchymal transition on HK-2 cells [J]. J Cell Physiol, 2018, 233(6): 4919-4925. doi: 10.1002/jcp.26310
    [28]

    Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method [J]. Methods, 2001, 25(4): 402-408. doi: 10.1006/meth.2001.1262
    [29]

    Yun HH, Park S, Chung M-J, et al. Effects of losartan and l-serine in a mouse liver fibrosis model [J]. Life Sci, 2021, 278: 119578. doi: 10.1016/j.lfs.2021.119578
    [30]

    Kalantar-Zadeh K, Jafar TH, Nitsch D, et al. Chronic kidney disease [J]. Lancet, 2021.https://doi.org/10.1016/S0140-6736(21)00519-5.
    [31]

    Webster AC, Nagler EV, Morton RL, et al. Chronic Kidney Disease [J]. Lancet, 2017, 389(10075): 1238-1252. doi: 10.1016/S0140-6736(16)32064-5
    [32]

    Zhou W, Chen MM, Liu HL, et al. Dihydroartemisinin suppresses renal fibrosis in mice by inhibiting DNA-methyltransferase 1 and increasing Klotho [J]. Acta Pharmacol Sin, 2022.https://doi.org/10.1038/s41401-022-00898-3.
    [33]

    Jin J, Zhou TJ, Ren GL, et al. Novel insights into NOD-like receptors in renal diseases [J]. Acta Pharmacol Sin, 2022.https://doi.org/10.1038/s41401-022-00886-7.
    [34]

    Cao G, Miao H, Wang YN, et al. Intrarenal 1-methoxypyrene, an aryl hydrocarbon receptor agonist, mediates progressive tubulointerstitial fibrosis in mice [J]. Acta Pharmacol Sin, 2022.https://doi.org/10.1038/s41401-022-00914-6.
    [35]

    Zhou W, Chen MM, Liu HL, et al. Recent advances of gut microbiota in chronic kidney disease patients [J]. Explor Med, 2022, 3(3): 260-274. doi: 10.1093/ckj/sfv026
    [36]

    Sun B, Wang X, Liu X, et al. Hippuric Acid Promotes Renal Fibrosis by Disrupting Redox Homeostasis via Facilitation of NRF2-KEAP1-CUL3 Interactions in Chronic Kidney Disease [J]. Antioxidants (Basel), 2020, 9(9).https://doi.org/10.3390/antiox9090783.
    [37]

    Devuyst O, Olinger E, Weber S, et al. Autosomal dominant tubulointerstitial kidney disease [J]. Nat Rev Dis Primers, 2019, 5(1): 60. doi: 10.1002/ajmg.c.32008
    [38]

    Rayego-Mateos S and Valdivielso JM. New therapeutic targets in chronic kidney disease progression and renal fibrosis [J]. Expert Opin Ther Targets, 2020, 24(7): 655-670. doi: 10.1080/14728222.2020.1762173
    [39]

    Lovisa S, Zeisberg M and Kalluri R. Partial Epithelial-to-Mesenchymal Transition and Other New Mechanisms of Kidney Fibrosis [J]. Trends Endocrinol Metab, 2016, 27(10): 681-695. doi: 10.1016/j.tem.2016.06.004
    [40]

    Sharma K, Ix JH, Mathew AV, et al. Pirfenidone for diabetic nephropathy [J]. J Am Soc Nephrol, 2011, 22(6): 1144-1151. doi: 10.1681/ASN.2010101049
    [41]

    Cho ME, Smith DC, Branton MH, et al. Pirfenidone slows renal function decline in patients with focal segmental glomerulosclerosis [J]. Clin J Am Soc Nephrol, 2007, 2(5): 906-913. doi: 10.2215/CJN.01050207
    [42]

    Voelker J, Berg PH, Sheetz M, et al. Anti-TGF-β1 Antibody Therapy in Patients with Diabetic Nephropathy [J]. J Am Soc Nephrol, 2017, 28(3): 953-962. doi: 10.1681/ASN.2015111230
    [43]

    Xue R, Li Y, Li X, et al. miR-185 affected the EMT, cell viability, and proliferation via DNMT1/MEG3 pathway in TGF-β1-induced renal fibrosis [J]. Cell Biol Int, 2019, 43(10): 1152-1162. doi: 10.1002/cbin.11046
    [44]

    Zhang J, Gu C, Noble NA, et al. Combining angiotensin II blockade and renin receptor inhibition results in enhanced antifibrotic effect in experimental nephritis [J]. Am J Physiol Renal Physiol, 2011, 301(4): F723-732. doi: 10.1152/ajprenal.00271.2011
    [45]

    Brenner BM, Cooper ME, de Zeeuw D, et al. Effects of losartan on renal and cardiovascular outcomes in patients with type 2 diabetes and nephropathy [J]. N Engl J Med, 2001.https://doi.org/10.1056/NEJMoa011161.
    [46]

    Yang J, Dai C, Liu Y. Hepatocyte growth factor gene therapy and angiotensin II blockade synergistically attenuate renal interstitial fibrosis in mice [J]. J Am Soc Nephrol, 2002, 13(10): 2464-2477. doi: 10.1097/01.asn.0000031827.16102.c1
    [47]

    Liu Y. Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention [J]. J Am Soc Nephrol, 2004, 15(1): 1-12. doi: 10.1097/01.asn.0000106015.29070.e7
    [48]

    Annaldas S, Saifi MA, Khurana A, et al. Nimbolide ameliorates unilateral ureteral obstruction-induced renal fibrosis by inhibition of TGF-β and EMT/Slug signalling [J]. Mol Immunol, 2019, 112: 247-255. doi: 10.1016/j.molimm.2019.06.003
    [49]

    Liu J, Zhong Y, Liu G, et al. Role of Stat3 Signaling in Control of EMT of Tubular Epithelial Cells During Renal Fibrosis [J]. Cell Physiol Biochem, 2017, 42(6): 2552-2558. doi: 10.1159/000480216
    [50]

    Zhu CZ, Doyle KJ, Nikkel AL, et al. Short-term oral gavage administration of adenine induces a model of fibrotic kidney disease in rats [J]. J Pharmacol Toxicol Methods, 2018, 94(Pt 1): 34-43.https://doi.org/10.1016/j.vascn.2018.04.003.
    [51]

    Varela VA, Oliveira-Sales EB, Maquigussa E, et al. Treatment with Mesenchymal Stem Cells Improves Renovascular Hypertension and Preserves the Ability of the Contralateral Kidney to Excrete Sodium [J]. Kidney Blood Press Res, 2019, 44(6): 1404-1415. doi: 10.1159/000503346
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(8) / Tables(2)

Article Metrics

Article views(203) PDF downloads(2) Cited by()

Related
Proportional views

Shen Qi Wan attenuates renal interstitial fibrosis via upregulating AQP1

    Corresponding author: Liting Ji, College of Pharmacy, Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China E-mail address: jltzcmu@sina.com; Xiaojie Zhou, Academy of Chinese Medical Sciences, Zhejiang Chinese Medical University, Hangzhou 310053, China E-mail address: 18768155681@163.com; Changyu Li, College of Pharmacy, Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China E-mail address: lcyzcmu@sina.com
  • 1. College of Pharmacy, Zhejiang Chinese Medical University, Hangzhou, Zhejiang 310053, China
  • 2. Academy of Chinese Medical Sciences, Zhejiang Chinese Medical University, Hangzhou 310053, China

Abstract: Shen Qi Wan (SQW), a famous traditional Chinese formula, has great effect on chronic kidney diseases (CKD). Renal interstitial fibrosis (RIF) is the crucial pathway in CKD leading to the end-stage renal failure. However, the underlying mechanism of SQW treat on RIF is unclear and needs further verification. To investigate the effect of SQW on RIF and explore the underlying mechanism of SQW on tubular epithelial-to-mesenchymal transition (EMT) through regulating of Aquaporin 1 (AQP1) expression level. An RIF mouse model was established by administration of adenine, and subsequently treated with SQW (3 or 6 g/kg/d, respectively) for 50 days. Following the treatment period, the levels of kidney functional parameters in serum were detected. The pathological renal changes and degree of fibrosis in the kidneys were analyzed by histological assessment. The expression of EMT-related markers and AQP1 gene expression in kidney tissues were measured using Real-time quantitative PCR (RT-qPCR) and Western blotting. In addition, EMT in HK-2 cells was induced using transforming growth factor-beta1 (TGF-β1), and this was followed by treatment with a serum containing SQW. Subsequently, the molecular mechanism of SQW on EMT was explored in HK-2 cells of AQP1 knockdown. SQW alleviated kidney injury and renal collagen deposition in the kidneys of mice induced by adenine, increased E-cadherin and AQP1 expression at the protein level, and decreased the expression of Vimentin and α-smooth muscle actin (α-SMA). Similarly, treatment with the serum containing SQW upregulated the expression of E-cadherin and Cytokeratin-18 (CK-18), and downregulated the expression of Vimentin and α-SMA significantly in TGF-β1 stimulated HK-2 cells. The expression levels of Snail and Slug were significantly upregulated in HK-2 cells following knockdown of AQP1. AQP1 knockdown increased the mRNA expression levels of Vimentin and α-SMA, while decreasing the expression levels of E-cadherin. The protein expression levels of Vimentin were increased, whereas E-cadherin and CK-18 expression levels were significantly decreased following AQP1 knockdown in the HK-2 cells. These results revealed that AQP1 knockdown promoted EMT. Furthermore, AQP1 knockdown abolished the protective effects of treatment with serum containing SQW on EMT in HK-2 cells. SQW halts EMT process in RIF via upregulation of the expression of AQP1 in kidneys.

    • Chronic kidney disease (CKD) is a common complicated disease with high morbidity and mortality. Currently, it is described as a change of kidney structure and/or function and classified by cause, values of glomerular filtration rate and albuminuria [1]. CKD affects 26–30 million adults in the United States and remains a major public health problem. The US Centers for Disease Control and Prevention project that 47% of 30-year-olds will develop CKD during their lifetime. Eleven percent of individuals with stage 3 CKD will eventually progress to end-stage renal disease (ESRD), requiring dialysis or kidney transplantation. CKD is also one of the strongest risk factors for cardiovascular disease. The costs to care for CKD (US$49 billion) are more than twice as large as ESRD costs ($23 billion) [2, 3]. Obviously, CKD presents enormous challenges to healthcare and it is essential to solve it.

      Renal interstitial fibrosis is regarded as an inevitable outcome involved in almost all cases of progressive chronic kidney diseases [4-6]. The hallmarks of RIF are progressive deposition of extracellular matrix (ECM) and impaired tubular architecture [7, 8]. The tubulointerstitial fibroblasts are the cells that contribute the most to progressive RIF [9]. Notably, epithelial-to-mesenchymal transition plays a vital role in driving the pathogenesis of RIF and thereby failure of kidney function [10-13]. A substantial proportion of fibroblast cells originate from epithelial cells via EMT [4, 14]. It has been shown that epithelial cells lose their original characteristics and express the features of fibroblasts after EMT [15].

      Despite the continuous development of therapeutics for management of RIF, effective therapeutic approaches to reverse RIF remain limited [16]. Thus, there is an urgent need for novel alternative therapeutic approaches to halt RIF.

      Shen Qi Wan is a famous traditional Chinese medicine (TCM) derived from Jin Kui Yao Lue [17, 18]. SQW is composed of eight Chinese traditional herbs as follows: Fuzi (Aconitum carmichaelii Debx), Rougui [Cinnamomum cassia (L.) J.Presl], Shudihuang [Rehmannia glutinosa (Gaertn.)DC.], Mudanpi [Moutan officinalis (L.) Lindl. & Paxton], Shanzhuyu (Cornus officinalis Siebold & Zucc.), Fulin [Poria cocos (Schw.) Wolf], Shanyao (Dioscorea opposita Thunb.) and Zhexie (Alisma acanthocarpum F.Muell.) [19-21]. SQW is widely used in the treatment of CKD clinically [22]. The protective effects of SQW on kidney dysfunction have been previously shown [20]. In our previous study, SQW was shown to relieve pathological renal damage and renal fibrosis in adenine-induced rats [19]. Additionally, it was shown that SQW could increase the protein expression levels of AQP1 in the kidneys of adenine-induced mice. However, the underlying mechanism of SQW on RIF remains unclear.

      AQP1 was the first discovered aquaporin amongst the family of water channel proteins [23]. In the kidney, AQP1 is expressed in the epithelial cells of the proximal tubules, apical membrane and in the basement membrane of the descending branch of the loop of Henle. It is vital for the maintenance of water homeostasis and concentrating the urine [24]. The decreasing changes that occur in AQP1 gene expression in renal tissues following renal injury are well established [25]. During EMT, epithelial cells can reduce water transport, resulting in an imbalance in the hydro-electrolyte balance [26]. In addition, a study showed that the functional consequence of EMT during RIF was arrest of cell cycle progression in the G2 phase, and reduced expression of several transporters, including AQP1 in tubular epithelial cells [10]. Ji Li et al. showed that aristolochic acid-1 induced EMT of proximal renal tubule cells, and this was accompanied by a reduction in AQP1 protein expression [27]. These findings suggest that the decrease in AQP1 expression is closely related to the development of EMT in renal tubule cells.

      The aim of the present study was to investigate the protective effects of SQW on RIF, and the role of AQP1 on EMT. We provided substantial evidence to show that SQW reversed EMT in an adenine-induced mouse model of RIF as well as in HK-2 cells exposed to TGF-β1. We further found that AQP1 knockdown triggered EMT, and highlighted the pivotal involvement of AQP1 in achieving the beneficial therapeutic effects of SQW on EMT. The present study contributes additional knowledge regarding the mechanism by which SQW exerts its beneficial effects in the management of RIF.

    Materials and Methods
    • SQW, consist of eight herbals (Table.1), was obtained from Zhongjing Wanxi Pharmaceutical Co., Ltd. (lot no. 200403, Henan, China). The quality of SQW was assessed using UPLC-Q/TOF-MS, the data from which is included as supplementary material (Additional file 1). Adenine was obtained from Shanghai Macklin Biochemical Co., Ltd (lot no.200403, Shanghai, China). Dulbecco’s modified Eagle’s medium (DMEM) was purchased by Invitrogen (Invitrogen, Carlsbad, CA, USA). Fetal bovine serum (FBS) was purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Phosphate buffer saline (PBS) solution were provided by Beijing Solarbio Technology Co., Ltd. (Beijing, China). Recombinant Human TGF-1 was obtained from PEPROTECH (lot no. 0715209, PeproTech, Inc., Rocky Hill, NJ, USA). RIPA lysis buffer and PMSF were purchased by Beyotime Institute of Biotechnology (Shanghai, China). The primary antibodies used were: anti-E-cadherin (cat. no. ab76055, Abcam, Cambridge, UK), anti-CK-18 (cat. no. ab32118, Abcam, Cambridge, UK), anti-α-SMA (cat. no. ab7818, Abcam, Cambridge, UK), anti-Vimentin (cat. no. ab92547, Abcam, Cambridge, UK), anti-Aquaporin 1 (cat. no. ab168387, Abcam, Cambridge, UK), anti-Slug (cat. no. ab51772, Abcam, Cambridge, UK), anti-Snail (cat. no. ab180174, Abcam, Cambridge, UK) and anti-GAPDH (cat. no. EM1101, Huaan Biotechnology, Co., Ltd., Hangzhou, Zhejiang, China). The peroxidase-conjugated secondary antibody of goat anti-rabbit and goat anti-mouse were obtained from (cat. no. C60113-05, cat. no.C70124-05, LI-COR Biosciences, Lincoln, NE, USA). The secondary antibody used for immunofluorescence staining was a goat anti-rabbit lgG antibody (cat. no. RS23220, ImmunoWay Biotechnology Company, Plano, TX, USA).

      Chinese nameHerbal nameBotanical nameQuantity percentiles (%)
      FuziAconiti Lateralis Radix PraeparataAconitum carmichaelii Debx.3.70
      RouguiCinnamomi CortexCinnamomum cassia (L.) J.Presl3.70
      ShudihuangRehmanniae Radix PraeparataRehmannia glutinosa Libosch.29.63
      ShanzhuyuCorni FructusCornus officinalis Sieb. et Zucc.14.82
      ShanyaoDioscoreae RhizomaDioscorea opposita Thunb.14.82
      FulingPoriaPoria cocos (Schw.) Wolf11.11
      MudanpiMoutan CortexPaeonia suffruticosa Andr.11.11
      ZexieAlismatis RhizomaAlisma orientale (Sam.) Juzep.11.11

      Table 1.  Composition of Shen Qi Wan

      GeneForward primer, 5’-3’Reverse primer, 5’-3’
      AQP1GTGCTATGCGTGCTGGCTACTACGGTGTCCAAGGGCTACAGAGAGG
      SnailGGCAATTTAACAATGTCTGAAAAGGGAATAGTTCTGGGAGACACATCG
      SlugACTCCGAAGCCAAATGACAACTCTCTCTGTGGGTGTGTGT
      E-cadherinGCTCTTCCAGGAACCTCTGTGATGTGTAAGCGATGGCGGCATTGTAG
      CK-18TCTCAGGACCTCGCCAAGATCATGTCGTCTCAGCAGCTCCAACCTC
      α-SMACTCTGGACGCACAACTGGCATCCACGCTCAGCAGTAGTAACGAAGG
      VimentinTTGCCGTTGAAGCTGCTAACTACCAATCCTGCTCTCCTCGCCTTCC
      GAPDHCAGGAGGCATTGCTGATGATGAAGGCTGGGGCTCATTT

      Table 2.  Sequences of the primers used for qPCR

    • All animal experiments were approved by the Ethics Committee of Zhejiang Chinese Medical University (Zhejiang, China). The C57BL/6 mice (male, 8 weeks old, weighing 25±2 g) were purchased from Shanghai BK Co., Ltd (Shanghai, China). All mice were housed under SPF grade conditions at a constant room temperature of 20±2 °C and 50-60% humidity, with ad libitum access to standard mouse chow and water.

      The mice were randomly divided into four groups (n=10/group): Control group, adenine group (75 mg/kg/d) and 2 different SQW dose groups (3 and 6 g/kg/d). Mice in all but the control group were administered adenine for 2 weeks to establish a model of kidney fibrosis. The mice in the SQW groups were treated with SQW (at the mentioned doses) after establishment of the RIF model for 3 weeks; the control group and Ade group were given an equivalent volume of water. Eventually, all mice were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg/kg) and euthanized by carbon dioxide (30% volume displacement/minute).

    • Male Sprague Dawley rats (weighing 200 ± 20 g) were purchased from Zhejiang Academy of Medical Sciences (Zhejiang, China) randomly divided into 4 groups (n = 8/group): the control group, and three SQW groups (1.5, 3.0 and 6.0 g/kg). The control group was administered an equivalent volume of water twice a day for 5 days. Rats in the SQW groups were administered with the different doses of SQW twice a day for 5 days. The rats were fasted for 12 h prior to preparation of the serum. After 2 h of final administration, 5 mL blood was collected under anesthesia. Then, blood samples were centrifuged at 1000 × g at 4 °C for 15 min. Finally, the serum was filtered using a 0.22 μm MILI filter and inactivated at 56 °C for 30 min, after which it was stored at –80 °C.

    • Human proximal tubular epithelial HK-2 cells were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China). HK-2 cells were cultured in DMEM containing 10% FBS. All cells were cultured in a humidified incubator at 37˚C with 5% CO2. Cells were randomly divided into five groups: Control group (cells were cultured in DMEM alone), the TGF-β1 group (cells were incubated with 10 ng/ml TGF-β1), the SQW-L group (cells were incubated with 10 ng/ml TGF-β1 and 10% 1.5 g/kg SQW drug-containing serum), the SQW-M group (cells were incubated with 10 ng/ml TGF-β1 and 10% 3 g/kg SQW drug-containing serum), and the SQW-H group (cells were incubated with 10 ng/ml TGF-β1 and 10% 6 g/kg SQW drug-containing serum); TGF-β1 was added to cells with or without test compounds for 48 h prior to subsequent treatments, after which, cells were cultured with the different doses of SQW drug-containing serum for 24 h.

    • The blood was centrifuged at 1000 × g for 10 min at 4 ˚C and the isolated serum was obtained. Urine samples were collected and centrifuged at 1000 × g for 5 min at 4 ˚C. The 24-h U-TP, serum BUN and Clearance rate of creatinine content analysis was performed immediately using an automatic biochemical detector (Hitachi, Ltd., Tokyo, Japan).

    • The kidney samples were fixed in 10% buffered formalin for 1 h with 4 °C, embedded in paraffin and sectioned using a microtome (RM2245, Leica Biosystems, USA). Then, sections were stained with hematoxylin and eosin to obverse the pathological renal changes. Images of sections were taken using the digital pathology scanner (VS120-S6-W, Olympus Corporation, Tokyo, Japan) at a 100 × magnification.

    • Tissues were dewaxed, soaked in potassium dichromate overnight then washed with tap water. Next, the sections were performed with a Masson modified IMEB stain kit (K7298, IMEB inc. San Marcos, CA), and imaged using the digital pathology scanner at a 100 × magnification to evaluate collagen fiber deposition. Semi-quantify of the renal fibrosis area on Masson-stained section was analysis by HIH image J.

    • Immunohistochemical analysis was performed to investigate AQP1 expression. The paraffin tissue sections was dewaxed in xylene and rehydrated in gradient ethanol solution. To quenched peroxidase activity, the sections was incubated with 3% H2O2 for 15 min. The samples was blocked with 5% goat serum for 10 min and then incubated with primary antibodies AQP1 (1:500) at 4 °C overnight. Then, the sections were incubated with the goat anti-rabbit IgG secondary antibody for 10 min at room temperature. 3,3-diaminobenzidine (DAB) and counterstained with hematoxylin were used to stain the sections. After dehydrating and drying, the sections were observed by a microscope. Computer-assisted image analysis was performed with Image J software.

    • Total protein was extracted from the kidney cortex and cells using RIPA lysis buffer containing PMSF and protease inhibitor for 30 min. All protein samples were centrifuged at 12,000 x g for 15 min (4 ˚C). Equivalent amounts of protein were loaded onto 8-10% SDS gels, resolved using SDS-PAGE and transferred to PVDF membranes. Subsequently, the membranes were blocked in 5% BSA at room temperature for 1 h, and then incubated overnight at 4 ˚C with the following primary antibodies: Anti-E-cadherin, anti-CK-18, anti-α-SMA, anti-Vimentin, anti-AQP1 or anti-GAPDH. After washing, the membranes were incubated with peroxidase-conjugated secondary antibodies. Densitometry analysis was performed using the Odyssey near-infrared dual-color laser imaging system (Odyssey Clx, LI-COR Biosciences, Lincoln, NE, USA).

    • Total RNA was extracted from the kidney tissues or HK-2 cells using a Takara MiniBEST Universal RNA Extraction kit (Takara Bio, Inc., Otsu, Japan). Reverse transcription reactions were performed using a PrimeScript™ RT MasterMix (Takara Bio, Inc., Otsu, Japan) for cDNA synthesis. The primer sequences of each gene are listed in Table 1. qPCR was performed using SYBR Green RT-qPCR Mix (Takara Bio, Inc., Otsu, Japan) on a CFX Connect Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Each experiment was performed strictly following the manufacturer’s instructions and the expression of genes was calculated using the 2-△△Cq method [28].

    • HK-2 cells were fixed using paraformaldehyde at 4 °C for 10 min, and then permeabilized using 0.2% Triton X-100. Next, normal goat serum was used to block cells, after which, the cells were incubated with primary antibodies against α-SMA and AQP1 at room temperature for 1 h, followed by incubation with the secondary antibodies for 1 h. Finally, nuclei were counterstained with DAPI (cat. no. D9542, MilliporeSigma-Aldrich; Merck KGaA, Burlington, MA, USA) and the cells were observed using the digital pathology scanner at a 200 × magnification.

    • Knockdown of AQP1 in HK-2 was performed by RNA interference vector of AQP1, which is constructed and packaged by Shanghai JiKai Gene Chemical Technology Co.,Ltd (Shanghai, China). Briefly, we screening the highest inference efficiency from three lentivirus with different interfering targets. Western blot and qRT-PCR were performed to verify the efficiency of AQP1 knockdown. The steps of lentivirus were strictly followed to manufactures’ instruction. Negative control lentivirus (NC) and lentivirus of AQP1 RNAi were used in the subsequent experiments.

    • Data are expressed as the mean ± standard deviation. SPSS version 22.0 (IBM Corp, Chicago, IL, USA) was used for statistical analysis. Differences between two unpaired groups was assessed using an unpaired Student’s t-test, whereas one-way ANOVA with Tukey’s multiple comparison test was used for comparison between three or more groups. P < 0.05 was considered to indicate a statistically significant difference.

    Result
    • The 24 h U-TP and serum BUN levels were detected to assess renal function in mice. As shown in (Figure 1 A-C), the levels of 24 h U-TP、BUN and clearance rate of CRE were significantly increased following adenine administration, whilst these levels were decreased in the SQW treated adenine induced groups. (P < 0.05 and P < 0.01).

      Figure 1.  The effect of SQW on renal function and RIF in adenine-induced mice. (A). The 24 h urine total protein levels. (B). The levels of serum BUN. (C). CRE clearance in ml/min. (D). Representative images of H&E and Masson’s trichrome staining of kidney tissue sections and semi-quantitative analysis of Masson staining (magnification, x200, Scale bar = 100 μm). Data are presented as the mean ± SD. *P < 0.05, **P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. Ade. SQW, Shen Qi Wan; RIF, renal interstitial fibrosis; BUN, blood urea nitrogen; Ade, adenine; H&E, hematoxylin and eosin; CRE, Cre recombinase.

      The morphological changes in the renal tissues of mice were observed using H&E staining. The changes in renal morphology were clearly observable in the adenine group; in contrast, SQW treatment at both doses notably alleviated the severity of the pathological damage. The excessive and disorganized deposition of collagen is the primary pathogenic feature of fibrotic tissue [29]. Masson staining showed increased levels of collagen in the adenine group compared with the control group, and SQW decreased the percent renal fibrosis area in the fibrotic kidneys in the adenine-induced mice (Figure 1 D).

    • Western blot analysis showed that adenine-induced mice exhibited EMT, as characterized by the upregulated expression of α-SMA and Vimentin, and the decrease in E-cadherin expression. SQW significantly reduced the expression of α-SMA and Vimentin protein levels, and increased the protein expression levels of E-cadherin. Moreover, adenine treatment significantly reduced the protein expression levels of AQP1 in kidney tissues. SQW treatment significantly reversed the decrease in AQP1 expression in the kidney tissues of the adenine-induced mice (Figure 2 A). Besides, immunohistochemistry studies reveled that AQP1 was highly upregulated in fibrotic kidney of mice after SQW treatment (Figure 2 B). These results indicate that SQW hinders renal tubular EMT progression in the adenine group, and AQP1 might play a key role in this process

      Figure 2.  The effect of SQW on the expression of EMT-related markers and AQP1 expression in adenine-induced mice. (A). E-cadherin, Vimentin, α-SMA and AQP1 protein expression in renal tissues. (B) Representative IHC images of AQP1 in the kidney tissues of mice along with quantitative analysis (n = 5). Data are presented as the mean ± SEM of three repeats. *P < 0.05, **P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. Ade. EMT, epithelial to mesenchymal transition; AQP1, aquaporin 1; SQW, Shen Qi Wan; Ade, adenine.

    • Cell morphology showed that HK-2 cells lost their epithelial appearance, and presented with an elongated and spindle-shaped morphology after being stimulated with TGF-β1. However, SQW drug-containing serum treatment significantly reduced this phenotype (Figure 3 A).

      Figure 3.  SQW-containing serum inhibits EMT induced by TGF-β1 in HK-2 cells. (A) The morphology of HK-2 cells after TGF-β1 treatment. (B). The expression of E-cadherin, CK-18, Vimentin and α-SMA was detected by western blot analysis. (C) Immunofluorescence staining images showed the expression of α-SMA in HK-2 cells. Scale bar = 100 μm. The data were normalized to the intensity of the respective GAPDH bands and are expressed relative to the value of the Control. Data are presented as the mean value ± SEM of three repeats. *P < 0.05, **P < 0.01 vs. Control; #P < 0.05, ##P < 0.01 vs. TGF-β1; △△P < 0.01 vs. SQW-L; &&P < 0.01 vs. SQW-M. SQW, Shen Qi Wan; SQW-L, SQW low dose; SQW-M, SQW medium dose; SQW-H, SQW high dose; EMT, epithelial to mesenchymal transition.

      Western blotting revealed the upregulation of α-SMA and Vimentin, and downregulation of E-cadherin and CK-18 after TGF-β1 treatment, whereas different treatment with doses of the SQW drug-containing serum significantly increased the expression of E-cadherin and CK-18, and decreased the expression of α-SMA and Vimentin at the protein level (Figure 3 B).

      Immunofluorescence analysis showed the increased expression of α-SMA in HK-2 cells incubated with TGF-β1. SQW-containing serum significantly decreased the expression of α-SMA (Figure 3 C). These results indicated that SQW-containing serum abrogated EMT in HK-2 cells induced by TGF-β1.

    • RT-qPCR analysis showed the relative mRNA expression levels of AQP1 were significantly reduced in the TGF-β1 group compared with the control group, whereas SQW-containing serum upregulated AQP1 mRNA expression levels compared with the TGF-β1 group (Figure 4 A).

      Figure 4.  The effect of SQW on AQP1 expression. (A). AQP1 mRNA levels were determined by reverse transcription-quantitative PCR. (B). The protein expression levels of AQP1 were detected by western blotting. (C). Immunofluorescence staining showing the expression of AQP1 in HK-2 cells. Scale bar = 100 μm. Data are presented as the mean value ± SEM of three repeats. *P < 0.05, **P < 0.01 vs. Control, #P < 0.05, ##P < 0.01 vs. TGF-β1. SQW, Shen Qi Wan; AQP1, aquaporin 1.

      Western blotting showed similar trends in AQP1 expression as that observed with the RT-qPCR analysis (Figure 4 B). Simultaneously, the immunofluorescence results showed lower expression of AQP1 in the TGF-β1 group compared with the control group, and SQW-containing serum significantly increased the expression of AQP1 (Figure 4 C).

    • To validate whether AQP1 knockdown mediated the occurrence of EMT, we transfected HK-2 cells with AQP1 RNAi lentivirus. The efficiency of gene knockdown was verified using RT-qPCR and western blotting. We found that LV3 was the most effective in knocking down expression of AQP1 at the mRNA level in HK-2 cells (Figure 5 A). Western blot analysis also showed that AQP1 expression was significantly suppressed by LV3 (Figure 5 B). The mRNA and protein expression levels of Snail and Slug were significantly increased after knockdown of AQP1 (P < 0.05, P < 0.01, Figure 5 C, Figure 5 D). RT-qPCR analysis also showed that the siAQP1 group exhibited lower E-cadherin mRNA expression, and higher Vimentin and α-SMA mRNA expression compared to the NC group (P < 0.01, Figure 5 D). Meanwhile, the protein levels of CK-18 and E-cadherin were significantly decreased, and Vimentin protein expression levels were significantly increased in HK-2 in cells where AQP1 expression had been knocked down (P < 0.01, Figure 5 E).

      Figure 5.  The effect of AQP1 knockdown on HK-2 cells. Effect of different lentiviral interference RNAs targeting AQP1 on the (A) mRNA and (B) protein expression levels of AQP1 in HK-2 cells. (C) Effect of AQP1 knockdown on the mRNA expression levels of AQP1, Snail and Slug in HK-2 cells. (D) The effect of AQP1 knockdown on the mRNA expression of E-cadherin, Vimentin and α-SMA in HK-2 cells. (E) The effect of AQP1 knockdown on the protein expression of E-cadherin, AQP1, Vimentin, CK-18, Snail and Slug in HK-2 cells. Data are presented as the mean ± SEM of three repeats. *P < 0.05, **P < 0.01 vs. NC. AQP1, aquaporin 1; NC, negative control.

    • To investigate the mechanism by which SQW prevented EMT, we examined the effect of SQW-containing serum in HK-2 cells in which AQP1 expression had been knocked down. RT-qPCR analysis showed that the mRNA expression levels of AQP1 and CK-18 were decreased, and that of α-SMA was increased in the siAQP1 group. There were no significant differences between the SQW + siAQP1 group and the siAQP1 group (P > 0.05, Figure 6A). Western blotting showed that AQP1 knockdown significantly decreased the expression of AQP1 and CK-18, and increased the expression of α-SMA, Vimentin, Snail and Slug as well. SQW-containing serum could not reverse EMT in cells in which AQP1 expression had been knocked down (P > 0.05, Figure 6B). These data suggest that SQW drug-containing serum inhibited EMT possibly via upregulation of AQP1.

      Figure 6.  Effect of SQW on EMT in cells in which AQP1 expression has been knocked down. (A). mRNA expression of AQP1, CK-18 and α-SMA in HK-2 cells. (B). The expression of AQP1, CK-18, Vimentin and α-SMA was detected by western blotting. Data are presented as the mean ± SEM. of three repeats. *P < 0.05, **P < 0.01 vs. NC group. SQW, Shen Qi Wan; AQP1, aquaporin 1; NC, negative control.

    Discussion
    • CKD is an incurable and progressive disease with high morbidity and mortality rates, and is common amongst the general adult population around the world [30, 31]. RIF is an unavoidable end result of the progression of CKDs [32, 33]. It has a typical characterized of excessive accumulation and deposition of extracellular matrix components [34, 35]. During RIF progression, the original function of the tissue is supplanted, thereby leading to the loss of the kidney architecture and function [36, 37]. RIF is a dynamic and complicated process, and its mechanism involves multiple molecular pathways and several kidney and infiltrating cells [31]. In the RIF process, tubular epithelial cells respond to injury by de novo expression of mesenchymal markers and reorganization of the actin cytoskeleton, this process is termed EMT [38]. Emerging evidence has shown that EMT is a key mechanism involved in the progression of RIF [10, 39]. Therefore, elucidation of the cellular and molecular pathways underlying EMT may contribute to the development of efficacious drugs to restore or slow the progression of RIF.

      Although new therapeutic strategies for RIF continue to emerge, the outcomes of these treatment approaches have been somewhat disappointing [38]. TGF-β is the most important profibrotic target of kidney fibrosis; however, the results of using approaches to reduce its expression have not been suitably studied [40-43]. Inhibition of Angiotensin II (Ang II) also attenuates EMT, thereby leading to a reduction in RIF progression. However, studies suggest that Ang II alone cannot inhibit fibrotic disease effectively [44-46]. These previous studies showed that it was difficult to alleviate RIF using only a single target. TCMs are composed of a series of active substances, which exert their therapeutic function via multiple targets directed at different mechanisms. As a famous TCM formula, SQW is commonly used for a wide range of chronic diseases [21]. In a previous study, we found that SQW could effectively ameliorate RIF in adenine-induced rats [19].

      In the present study, we explored the effects of SQW on RIF in adenine-induced mice. The results indicated that SQW notably ameliorated damage to kidney function, alleviated pathological damage to kidneys, and decreased the deposition of collagen fiber in mice administrated adenine. We also observed that SQW significantly increased the expression of E-cadherin and AQP1, and decreased the expression of α-SMA and Vimentin. Similar to the in vivo experiments, we observed that serum containing SQW ameliorated the cellular morphological damage and inhibited EMT by upregulating E-cadherin and CK-18 expression at the protein level, whilst downregulating α-SMA and Vimentin expression in HK-2 cells stimulated with TGF-β1. These results indicated that SQW could effectively hinder the progression of EMT. However, the mechanism underlying the beneficial effects of SQW on EMT remain largely unknown.

      EMT is a phenotypic process of conversion that is fundamentally related to the pathogenesis of RIF [47]. Several factors and intracellular signaling pathways have been implicated in mediating EMT. TGF-β1 is the most important inducer involved in the entire EMT process [48, 49]. According to the results of the present study, we found that SQW enhanced the expression of AQP1 in the RIF mouse model and in the HK-2 cells stimulated with TGF-β1. Previous work has indicated that the expression of AQP1 was altered in the renal tissues involved in kidney injury [50, 51]. It was shown that AQP1 expression was downregulated during EMT induced by Aristolochic acid I in HK-2 cells, whilst another study showed that lower expression of AQP1 was observed during EMT in kidney fibrosis [10]. Nevertheless, the role of AQP1 in EMT remains unclear. To further understand the role of AQP1 in EMT, we knocked down AQP1 in HK-2 cells and investigated the expression of EMT-related markers. Indeed, the expression levels of Snail and Slug were significantly increased following AQP1 knockdown. Furthermore, AQP1 knockdown could exacerbate the progression of EMT through increasing the expression of epithelial markers and decreasing the expression of mesenchymal markers. Our study is the first to show that AQP1 knockout could cause EMT progression to the best of our knowledge. To further explore the mechanism of SQW on management of EMT and the role of AQP1 in this process, serum containing SQW was used to treat the HK-2 which had had AQP1 expression knocked out. The results showed that SQW could not reserve the EMT induced by AQP1 knockout. These results demonstrated that SQW may reverse EMT in RIF via upregulation of AQP1. In future studies, we will overexpress AQP1 in HK-2 cells to firmly establish the role of AQP1 in EMT. In addition, AQP1 knockout mice will be used to further explore the role of AQP1 in the mechanism of SQW on EMT. Altogether, the present study demonstrated the protective effects of SQW on RIF via inhibition of EMT. Additionally, AQP1 may have been the therapeutic target of SQW by which it reversed EMT, and thereby ameliorated RIF. However, the protective role of SQW on renal fibrosis in AQP1-knockout mice needs further explore.

    Conclusion
    • In conclusion, SQW was shown to exert an ameliorative effect on RIF by reversing EMT in adenine-induced mice. Moreover, SQW significantly attenuated EMT in HK-2 cells induced by TGF-β1. The expression of AQP1 was significantly increased in both adenine-induced mice and HK-2 cells stimulated by TGF-β1 after treatment with SQW. Most notably, our findings indicated that AQP1 knockdown promoted EMT. SQW treatment did not exert any beneficial effects in the AQP1 knockdown cells and stimulated with TGF-β1. Together, these results showed that SQW could attenuate RIF by increasing the expression of the AQP1 gene.

    Contributions of Author
    • YL, LJ and CL conceived and designed the study. YL and XZ performed the experiments. YZ, JH and SW analyzed the data. QL, HY and JW conducted the animal experiments. YL and JW wrote the article. YL and JW contributed equally to this work. LJ,XZ and CL contributed equally to this work.

    Declaration of Competing Interests
    • The authors declare that they have no competing interests.

Reference (51)

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return